RIKEN
     
CUEs
 
Home
Metagenomic Data
About Enzymes
Data Sources
Riken
Team
Contact
 
Please select an option
 
 Sequence Type
 Search Using
[ Max. 300,000 characters or 50 sequences ]  Query sequence(s) should be pasted in the text<br/>
area or can be uploaded by choosing upload file<br/> 
option. The format of the sequence(s) or file must<br/>
be FASTA. e.g., <br/><font color='#A60053'>>test_seq<br/>
aaatccccttctaaaaatggatattttacactttttacctca<br/>
ttgcaagtatctaaaaattttgctactttaagtgtgcttgca<br/>
ctatgttctttcattctcaatccaagtgtctcaagcccttga<br/>
ataagtaaccaagaattaaatggtgcgggtacacttcctaag<br>
tctctcattaatccaagtctagctctcagacaaaatgctgga<br/>
aatccttcaagttgagtatatactaaaccatga</font>

 OR

[max 10 MB]
 E-value [Default is 10-6]
 Dataset
 Output Format

 

   
Version 1.0, Copyright © 2009-2017 Laboratory for Integrated Bioinformatics, RIKEN, Japan
This site is best viewed with Internet Explorer 6.0+ and Mozilla/Firefox 3.0+.